Learn More
Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO118
430.35 DKK valid until 2025-08-24
Use promo code "24117" to get your promotional price.
Description
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'
Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

Specifications
SP6, T3, T7 | |
T7 promoter Sequencing Primer, 20-mer, 10 μM Store at –20°C. |
|
10 ÎĽM | |
10 ÎĽM | |
Sequencing |
Sequencing Primer | |
Dry Ice | |
T7 | |
pTZ19R, pTZ57R, pBluescript II | |
Liquid |
Certificates
A lot number is required to show results for certificates. To find your lot number on previous orders use our order status area.
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.